Review



gfp tagged adeno associated virus aav vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc gfp tagged adeno associated virus aav vector
    Gfp Tagged Adeno Associated Virus Aav Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+tagged+adeno+associated+virus+aav+vector/AAV+GFP+(Plasmid+%2349055)/pm41291187-61-17-22
    Average 95 stars, based on 63 article reviews
    gfp tagged adeno associated virus aav vector - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Knockdown:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    shRNA:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Sequencing:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Clone Assay:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Virus:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Bioprocessing:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Plasmid Preparation:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.

    Control:

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition
    Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model.
    Article Snippet: .. The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor. ..

    Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice.
    Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into GFP-tagged adeno-associated virus (AAV) -vector (Addgene) under the control of U6 promoter. .. Viral particles (titer: 5.23 × 1012 vg/mL) were produced by the Obio Technology (Shanghai) Corp., Ltd. To re-express Sh3rf3, the Sh3rf3 sequence (GeneID:237353) was cloned into the pAAV-hSyn-EGFP-P2A-tWPA vector.



    Similar Products

    95
    Addgene inc gfp tagged adeno associated virus aav vector
    Gfp Tagged Adeno Associated Virus Aav Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+tagged+adeno+associated+virus+aav+vector/AAV+GFP+(Plasmid+%2349055)/pm41291187-61-17-22
    Average 95 stars, based on 1 article reviews
    gfp tagged adeno associated virus aav vector - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    90
    Addgene inc gfp-tagged adeno-associated virus (aav) vector
    a Quantitative PCR analysis showing mRNA levels of Fbxo2 in N2A cells transfected with <t>Fbxo2</t> <t>shRNA</t> or a scrambled control shRNA ( n = 3 cultures/group, t = 29.3, p < 0.0001, t test). b A representative fluorescent image showing viral-infected PFC from a mouse with the stereotaxic injection of Fbxo2 shRNA AAV <t>(GFP-tagged).</t> Scale bar: 1000 μm. This experiment was repeated 3 times independently with similar results. c Quantitative PCR analysis showing Fbxo2 mRNA levels in PFC of Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV (n = 5 mice/group, t = 3.7, p = 0.02, t test). d Input–output curves of NMDAR-EPSC in response to a series of stimulation intensities in PFC layer V pyramidal neurons in Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 13–16 cells/3 mice/group, F 1,27(group) = 9.1, p = 0.006, two-way rmANOVA). Inset: representative eEPSC traces at different stimulation intensities. e , f Bar graphs showing investigation time on novel (N) and familiar (F) objects ( e ), and discrimination indexes ( f ) for NOR tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, e , F 3,34(int e raction) = 4.1, p = 0.01; f , F 1,17(treatment) = 13.1, p = 0.002, F 1,17(interaction) = 12.9, p = 0.002, two-way ANOVA). g , h Bar graphs showing investigation time on correct (T1) and incorrect (T2) holes ( g ), and spatial memory indexes ( h ) for BM tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, g , F 3,34(interaction) = 4.9, p = 0.006; h , F 1,17(treatment) = 4.2, p = 0.06, F 1,17(interaction) = 21.8, p = 0.0002, two-way ANOVA). In all figures, * p < 0.05, ** p < 0.01, ***p < 0.001. i A schematic model showing that Smyd3 elevation in AD leads to Fbxo2 upregulation because of increased H3K4me3 occupancy, resulting in more NR1 ubiquitination and diminished NMDAR function in PFC, causing cognitive impairment. Smyd3 inhibition or Fbxo2 knockdown provides an intervention avenue to rescue synaptic and behavioral deficits in Tau AD mice. The diagram was created with Biorender. Data are presented as mean values ± SEM. Detailed statistical data are provided in Source Data files.
    Gfp Tagged Adeno Associated Virus (Aav) Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+tagged+adeno+associated+virus+aav+vector/pgp+cmv+gcamp6m/pmc09822922-309-5-10
    Average 90 stars, based on 1 article reviews
    gfp-tagged adeno-associated virus (aav) vector - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    a Quantitative PCR analysis showing mRNA levels of Fbxo2 in N2A cells transfected with Fbxo2 shRNA or a scrambled control shRNA ( n = 3 cultures/group, t = 29.3, p < 0.0001, t test). b A representative fluorescent image showing viral-infected PFC from a mouse with the stereotaxic injection of Fbxo2 shRNA AAV (GFP-tagged). Scale bar: 1000 μm. This experiment was repeated 3 times independently with similar results. c Quantitative PCR analysis showing Fbxo2 mRNA levels in PFC of Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV (n = 5 mice/group, t = 3.7, p = 0.02, t test). d Input–output curves of NMDAR-EPSC in response to a series of stimulation intensities in PFC layer V pyramidal neurons in Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 13–16 cells/3 mice/group, F 1,27(group) = 9.1, p = 0.006, two-way rmANOVA). Inset: representative eEPSC traces at different stimulation intensities. e , f Bar graphs showing investigation time on novel (N) and familiar (F) objects ( e ), and discrimination indexes ( f ) for NOR tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, e , F 3,34(int e raction) = 4.1, p = 0.01; f , F 1,17(treatment) = 13.1, p = 0.002, F 1,17(interaction) = 12.9, p = 0.002, two-way ANOVA). g , h Bar graphs showing investigation time on correct (T1) and incorrect (T2) holes ( g ), and spatial memory indexes ( h ) for BM tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, g , F 3,34(interaction) = 4.9, p = 0.006; h , F 1,17(treatment) = 4.2, p = 0.06, F 1,17(interaction) = 21.8, p = 0.0002, two-way ANOVA). In all figures, * p < 0.05, ** p < 0.01, ***p < 0.001. i A schematic model showing that Smyd3 elevation in AD leads to Fbxo2 upregulation because of increased H3K4me3 occupancy, resulting in more NR1 ubiquitination and diminished NMDAR function in PFC, causing cognitive impairment. Smyd3 inhibition or Fbxo2 knockdown provides an intervention avenue to rescue synaptic and behavioral deficits in Tau AD mice. The diagram was created with Biorender. Data are presented as mean values ± SEM. Detailed statistical data are provided in Source Data files.

    Journal: Nature Communications

    Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model

    doi: 10.1038/s41467-022-35749-6

    Figure Lengend Snippet: a Quantitative PCR analysis showing mRNA levels of Fbxo2 in N2A cells transfected with Fbxo2 shRNA or a scrambled control shRNA ( n = 3 cultures/group, t = 29.3, p < 0.0001, t test). b A representative fluorescent image showing viral-infected PFC from a mouse with the stereotaxic injection of Fbxo2 shRNA AAV (GFP-tagged). Scale bar: 1000 μm. This experiment was repeated 3 times independently with similar results. c Quantitative PCR analysis showing Fbxo2 mRNA levels in PFC of Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV (n = 5 mice/group, t = 3.7, p = 0.02, t test). d Input–output curves of NMDAR-EPSC in response to a series of stimulation intensities in PFC layer V pyramidal neurons in Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 13–16 cells/3 mice/group, F 1,27(group) = 9.1, p = 0.006, two-way rmANOVA). Inset: representative eEPSC traces at different stimulation intensities. e , f Bar graphs showing investigation time on novel (N) and familiar (F) objects ( e ), and discrimination indexes ( f ) for NOR tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, e , F 3,34(int e raction) = 4.1, p = 0.01; f , F 1,17(treatment) = 13.1, p = 0.002, F 1,17(interaction) = 12.9, p = 0.002, two-way ANOVA). g , h Bar graphs showing investigation time on correct (T1) and incorrect (T2) holes ( g ), and spatial memory indexes ( h ) for BM tests of WT or Tau mice infected with Fbxo2 shRNA or scrambled shRNA AAV ( n = 4–6 mice/group, g , F 3,34(interaction) = 4.9, p = 0.006; h , F 1,17(treatment) = 4.2, p = 0.06, F 1,17(interaction) = 21.8, p = 0.0002, two-way ANOVA). In all figures, * p < 0.05, ** p < 0.01, ***p < 0.001. i A schematic model showing that Smyd3 elevation in AD leads to Fbxo2 upregulation because of increased H3K4me3 occupancy, resulting in more NR1 ubiquitination and diminished NMDAR function in PFC, causing cognitive impairment. Smyd3 inhibition or Fbxo2 knockdown provides an intervention avenue to rescue synaptic and behavioral deficits in Tau AD mice. The diagram was created with Biorender. Data are presented as mean values ± SEM. Detailed statistical data are provided in Source Data files.

    Article Snippet: The shRNA was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor.

    Techniques: Real-time Polymerase Chain Reaction, Transfection, shRNA, Control, Infection, Injection, Inhibition, Knockdown