gfp tagged adeno associated virus aav vector (Addgene inc)
Structured Review
Gfp Tagged Adeno Associated Virus Aav Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gfp+tagged+adeno+associated+virus+aav+vector/AAV+GFP+(Plasmid+%2349055)/pm41291187-61-17-22
Average 95 stars, based on 63 article reviews
Images
Related Articles
Knockdown:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into shRNA:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Sequencing:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Clone Assay:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Virus:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Bioprocessing:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Plasmid Preparation:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into Control:Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition Article Snippet: Five-week-old C57BL/6J mice (Strain #: 000664, The Jackson Lab) were used in this study. .. To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into Article Title: Inhibition of histone methyltransferase Smyd3 rescues NMDAR and cognitive deficits in a tauopathy mouse model. Article Snippet: .. The shRNA was cloned into Article Title: Sh3rf3 Deficiency drives autism-like behaviors via presynaptic dysfunction in mice. Article Snippet: .. To knock down Sh3rf3, short-hairpin RNA (shRNA) sequence (CCTGGCTCTCTATGCATACAA) and ctrl shNC2 RNA (CCTAAGGTTAAGTCGCCCTCG) were cloned into |
